RNA splicing is a cellular process that is critical for gene expression. After genes are copied from DNA into messenger RNA, ...
Announcing a new article publication for Cardiovascular Innovations and Applications journal. Alternative splicing (AS), a critical process for gene expression regulation, allows a single precursor ...
Objectives Idiopathic inflammatory myopathies (IIMs) are a group of heterogeneous autoimmune diseases. Intron retention (IR) serves as an important post-transcriptional and translational regulatory ...
A research team has identified the core gene expression networks regulated by key proteins that fundamentally drive phenomena such as cancer development, metastasis, tissue differentiation from ...
Not all stressors have the same impact on health. Stress arising from threats to social safety is most likely to affect psychological, biological, and clinical outcomes. This is the conclusion ...
The TP53 gene is a gene that is mutated in many cancers. It is the most common gene mutation found in cancer cells. A tumor-suppressor gene, TP53 codes for a protein that inhibits the development and ...
Amplification conditions and primers are available on request. We amplified the entire coding region and the exon/intron boundaries of TCIRG1 as follows. We amplified cDNA in five segments ...
Alternative splicing is an important mechanism for the regulation of gene expression in eukaryotes during development ... This was possible because 3' and subsequent 5' splice sites mark exon ...
Somatic Deletion in Exon 10 of Aryl Hydrocarbon Receptor Gene in Human GH-Secreting Pituitary Tumors
However, no somatic changes in AHR gene have been reported so far in acromegaly ... chr7:17338740+17339068 (329bp) Intron 9-10Fw 5’- GTAGGGATGTAACCTGACC-3’ and Exon 10_83bp 5’- CATACAACACAGCTTCTCCAGTG ...
Some results have been hidden because they may be inaccessible to you
Show inaccessible results
Feedback